# Synthetic Biology

Canonical URL: https://shipslides.com/d/future-synthetic-biology
Raw viewer URL: https://content.shipslides.com/d/future-synthetic-biology/raw
Category: Future
Slides: 30
Updated: 2026-05-17T20:51:48.942Z
Tags: future, synthetic, biology

## Summary

Engineering life at the molecular level — rewriting the code of existence Key sections include: Synthetic Biology; What Is Synthetic Biology?; From Mendel to CRISPR; Core Technologies; CRISPR: The Gene Scissor; Healing the Human Body; Feeding a Growing World; The Bioeconomy; Healing the Planet; The $30 Trillion Opportunity.

## Slide Outline

1. Synthetic Biology
2. What Is Synthetic Biology?
3. From Mendel to CRISPR
4. Core Technologies
5. CRISPR: The Gene Scissor
6. Healing the Human Body
7. Feeding a Growing World
8. The Bioeconomy
9. Healing the Planet
10. The $30 Trillion Opportunity
11. Leading Companies
12. Biosecurity Challenges
13. Ethical Frontiers
14. DNA as Data Storage
15. Biofoundries: Labs of Tomorrow
16. The Minimal Cell
17. Lab-Grown Everything
18. Living Biomaterials
19. Cells That Compute
20. iGEM: The Global Movement
21. AlphaFold: Solving Proteins
22. Xenobiology: Alien Alphabets
23. Technical Hurdles
24. Regulatory Landscape
25. Bio as Strategic Asset
26. Engineering Longevity
27. Biology Meets Everything
28. Synthetic Biology 2030 Roadmap
29. Rewriting Civilization
30. The Biological Century

## Slide Transcript

### Slide 1: Synthetic
Biology

- Future Technologies
- Engineering life at the molecular level — rewriting the code of existence
- ATCG · GCTA · TACG · CGAT · ATCG · GCTA
- 01 / 30

### Slide 2: What Is Synthetic Biology?

- Definition
- An interdisciplinary field applying engineering principles to biological systems — designing and constructing new biological parts, devices, and organisms, or redesigning existing natural systems from scratch.
- Design
- Engineer genetic circuits like electronic circuits — modular, predictable, reusable components assembled from standard biological parts.
- Build
- Synthesize DNA sequences from scratch using automated synthesis platforms, base by base, with increasing fidelity.
- Test & Learn
- Rapidly iterate using high-throughput screening, sequencing, and machine learning to optimize biological function.
- 02 / 30
- Synthetic Biology

### Slide 3: From Mendel to CRISPR

- History
- 1953
- DNA Double Helix
- Watson & Crick reveal the structure of DNA — the blueprint of all life.
- 1973
- Recombinant DNA
- Cohen & Boyer achieve the first successful gene splicing and cloning in bacteria.
- 2000
- Human Genome Project
- First draft of the full human genome — 3 billion base pairs sequenced in 13 years.
- 2003
- BioBricks Standard
- MIT introduces standardized biological parts — the "Lego bricks" of synthetic biology.
- 2012
- CRISPR-Cas9
- Doudna & Charpentier demonstrate programmable gene editing — 2020 Nobel Prize in Chemistry.
- 2021
- AlphaFold
- AI predicts 200 million protein structures, solving a 50-year-old central problem in biology.
- 03 / 30
- Synthetic Biology

### Slide 4: Core Technologies

- Technology
- CRISPR-Cas9 — Precision gene editing at any position in the genome with 99.9%+ accuracy
- DNA Synthesis — Writing novel DNA sequences from chemical precursors, base by base
- Next-Gen Sequencing — Reading full genomes in hours for under $200, enabling rapid design iteration
- Cell-Free Systems — Running biological reactions outside living cells for safer, faster prototyping
- Genetic Circuits — Boolean logic gates built from DNA: AND, OR, NOT operations in living cells
- Directed Evolution — Accelerated Darwinian selection to evolve proteins with custom properties
- Metabolic Engineering — Rewiring cellular metabolism to produce valuable molecules at scale
- AI-Assisted Design — ML models predicting protein folding, genetic function, and design outcomes
- 04 / 30
- Synthetic Biology

### Slide 5: CRISPR: The Gene Scissor

- Spotlight
- A natural bacterial immune system repurposed as the most powerful gene-editing tool ever created — guide RNA finds the target, Cas9 cuts, and the cell's own repair machinery makes the edit.
- Guide RNA locates the exact target DNA sequence in 3 billion base pairs
- Cas9 protein makes a precise double-strand cut
- Cell's repair machinery inserts, deletes, or corrects the gene
- Can address point mutations, gene knockouts, or large insertions
- 99.9%
- targeting precision in optimized systems
- 1,000×
- cheaper than previous methods
- 2020
- Nobel Prize in Chemistry
- 05 / 30
- Synthetic Biology

### Slide 6: Healing the Human Body

- Medicine
- Gene Therapy
- Correcting mutations that cause sickle cell, cystic fibrosis, and muscular dystrophy at the genetic source.
- CAR-T Cancer Therapy
- Engineering a patient's own T-cells to recognize and destroy tumors — achieving remission in previously untreatable cancers.
- mRNA Vaccines
- Synthetic mRNA trains the immune system without viral vectors — enabling rapid vaccine development for any pathogen.
- CRISPR Diagnostics
- SHERLOCK and DETECTR use CRISPR for ultra-sensitive pathogen detection in under 30 minutes.
- Xenotransplantation
- Editing pig genomes to make organs compatible with humans — potentially solving the organ donor shortage.
- Living Medicines
- Engineered bacteria colonizing the gut, continuously monitoring and dispensing therapeutic molecules on demand.
- 06 / 30
- Synthetic Biology

### Slide 7: Feeding a Growing World

- Agriculture
- Nitrogen fixation — Engineering crops to fix their own nitrogen, eliminating synthetic fertilizer dependence
- Disease resistance — Inserting genes for resistance to fungal, bacterial, and viral pathogens
- Drought tolerance — Plants that thrive with 50% less water through engineered stress responses
- Nutritional enhancement — Golden Rice delivers beta-carotene where deficiency causes 500,000 cases of childhood blindness
- Faster growth — Improved photosynthesis efficiency boosts crop yields 40% in field trials
- 40%yield increase via photosynthesis engineering
- 10Bpeople to feed by 2050
- 80%reduction in pesticide use achievable
- 07 / 30
- Synthetic Biology

### Slide 8: The Bioeconomy

- Industry
- Microbes engineered as microscopic factories are replacing petroleum-derived chemicals, plastics, and materials with sustainable biological alternatives.
- Biofuels
- Yeast converting sugarcane waste into jet fuel, eliminating food-crop competition for aviation decarbonization.
- Spider Silk
- Bacteria producing silk proteins — 5× stronger than steel by weight, fully biodegradable and biocompatible.
- Bioplastics
- PHA plastics grown in bacteria from waste feedstocks — fully compostable in 90 days in home conditions.
- Bio-dyes
- Replacing toxic textile dyes with microbe-produced pigments — zero toxic wastewater in the dyeing process.
- 08 / 30
- Synthetic Biology

### Slide 9: Healing the Planet

- Environment
- Carbon capture — Engineered cyanobacteria absorbing CO₂ at 10× natural rates, storing it as solid carbonate minerals
- Plastic degradation — Evolved PETase enzymes breaking down PET plastic in days rather than centuries
- Oil spill cleanup — Bacteria metabolizing crude oil components as their primary carbon and energy source
- Heavy metal extraction — Microbes selectively binding and concentrating toxic metals from contaminated water
- Gene drive — Spreading malaria-resistant genes through wild mosquito populations to eliminate 600,000 deaths per year
- De-extinction — Woolly mammoth genes inserted into elephant genomes to restore Arctic grasslands and slow permafrost thaw
- "We are at an inflection point. For the first time, we can read, write, and edit the code of life itself."
- — George Church, Harvard Genetics
- 09 / 30
- Synthetic Biology

### Slide 10: The $30 Trillion Opportunity

- Market
- McKinsey estimates synthetic biology could touch 60% of global physical inputs — up to $4 trillion in annual economic value within 10–20 years.
- $30Tpotential economic impact over 20 years
- 45%CAGR of synbio market 2020–2030
- 6,000+synbio companies founded since 2010
- $20BVC invested in synbio in 2021 alone
- 10 / 30
- Synthetic Biology

### Slide 11: Leading Companies

- Players
- Ginkgo Bioworks
- The "cell programming" platform — running automated genetic engineering at industrial scale for pharma, food, agriculture, and defense.
- Impossible Foods
- Yeast-produced heme protein replicates beef flavor — reaching mass market shelves globally without a single cow.
- Bolt Threads
- Mycelium leather and spider silk textiles replacing animal and petroleum-based materials in fashion and apparel.
- Moderna / BioNTech
- mRNA platform validated at global scale by COVID vaccines — now developing personalized cancer and HIV therapeutics.
- Pivot Bio
- Microbes applied to corn roots that fix atmospheric nitrogen — eliminating synthetic nitrogen fertilizer for millions of acres.
- UPSIDE Foods
- First USDA/FDA-approved cultivated chicken grown directly from animal cells — no slaughter required in the supply chain.
- 11 / 30
- Synthetic Biology

### Slide 12: Biosecurity Challenges

- Risks
- Bioweapons — Engineered pathogens with enhanced transmissibility represent the field's most severe dual-use risk
- DIY biology — Desktop DNA synthesizers make dangerous experiments accessible outside institutional oversight
- Ecological disruption — Gene-drive organisms could cascade through ecosystems with unpredictable consequences
- Accidental release — Engineered organisms escaping containment could outcompete native species and disrupt food webs
- Governance Responses
- DNA synthesis screening — databases flag dangerous sequences before production
- WHO biosafety frameworks for dual-use research of concern
- DARPA Safe Genes program developing reversal mechanisms
- International Biological Weapons Convention updates underway
- 12 / 30
- Synthetic Biology

### Slide 13: Ethical Frontiers

- Ethics
- Human Enhancement
- Should we edit embryo genomes to prevent disease? Enhance intelligence? Where is the line between therapy and enhancement?
- Playing God
- Creating new life forms raises profound questions about humanity's role and responsibility in the biosphere — who decides?
- Access & Equity
- Will $3M gene therapies only benefit the wealthy? Or will platform biology democratize medicine globally?
- Intergenerational Consent
- Germline edits affect all future descendants who cannot consent. Who speaks for generations not yet born?
- Animal Rights
- Engineering animals as organ factories or food sources raises questions about moral status, suffering, and dignity.
- IP & Ownership
- Who owns engineered organisms? Can life be patented? How do we handle biopiracy of indigenous genetic resources?
- 13 / 30
- Synthetic Biology

### Slide 14: DNA as Data Storage

- Innovation
- DNA is nature's ultimate storage medium — stable for thousands of years, packed more densely than any silicon chip, and readable with increasingly cheap sequencers.
- 1 gram of DNA stores 215 petabytes of data
- DNA survives intact for 700,000+ years in cold, dry conditions
- Microsoft has successfully stored and retrieved entire movies and OS files in synthetic DNA
- Twist Bioscience synthesizes DNA at $0.01/base and falling
- Could store all of humanity's data in a shoebox-sized DNA archive
- ATCGGCTATACGATCGGCTATACG
- GCTATACGATCGGCTATACGATCG
- TACGATCGGCTATACGATCGGCTA
- CGATCGGCTATACGATCGGCTATA
- 215 PB
- per gram of synthetic DNA
- 14 / 30
- Synthetic Biology

### Slide 15: Biofoundries: Labs of Tomorrow

- Infrastructure
- Automated, high-throughput facilities that run the Design-Build-Test-Learn cycle at industrial speed — compressing years of research into weeks.
- Liquid handling robots — Pipette millions of nanoliter samples per day with precision impossible for human hands
- Colony pickers — Select transformed bacterial colonies at 10,000 per hour autonomously
- Flow cytometers — Screen millions of cells per second for desired traits
- ML-driven DBTL loops — Each experimental cycle informs the next through AI pattern recognition
- Cloud biology — Remote access to biofoundry robots democratizing synbio globally
- Global Biofoundry Alliance
- 19 national biofoundries across 14 countries collaborating on standards, training, and shared platforms.
- 100×faster design cycles vs. traditional wet labs
- 15 / 30
- Synthetic Biology

### Slide 16: The Minimal Cell

- Breakthrough
- In 2016, the J. Craig Venter Institute created JCVI-syn3.0 — the organism with the smallest known genome capable of self-replication — defining the minimum requirements for life itself.
- Only 473 genes — stripped from the natural Mycoplasma genome of 900+ genes
- 149 genes (31%) have unknown function — essential yet mysterious
- Creates a blank-slate chassis for loading custom genetic programs
- Enables true "ground-up" organism design without evolutionary baggage
- Successor JCVI-syn3A grows at the same rate as wild-type bacteria
- 473
- genes in JCVI-syn3.0
- ~20,000
- genes in human genome
- 531 kbp
- total genome size in base pairs
- 16 / 30
- Synthetic Biology

### Slide 17: Lab-Grown Everything

- Food
- Cultivated Meat
- Growing beef, chicken, and fish from stem cells — same taste, 99% less land, 96% fewer emissions than conventional livestock.
- Precision Fermentation
- Yeast producing identical milk proteins — animal-free dairy with exactly the same flavor, nutrition, and texture as cow's milk.
- Algae Protein
- Engineered microalgae yielding 10× more protein per acre than soybeans while purifying water and absorbing CO₂.
- The first commercial cultivated meat was USDA/FDA-approved in June 2023. UPSIDE Foods and Good Meat now sell chicken grown from cells in US restaurants. Singapore approved cultivated chicken in 2020, the world's first regulatory clearance.
- 1 cellproduces 10,000 kg of meat at scale
- 17 / 30
- Synthetic Biology

### Slide 18: Living Biomaterials

- Materials
- Mycelium composites — Mushroom roots forming lightweight, fire-resistant packaging stronger than styrofoam, fully compostable
- Self-healing concrete — Bacteria embedded in concrete activate with water, autonomously sealing structural cracks
- Living building materials — Cyanobacteria-infused bricks that grow, adapt, and self-repair when damaged
- Bioelectronics — Bacterial nanowires conducting electricity for flexible, biodegradable electronics and sensors
- Bioprinted organs — 3D-printed scaffolds seeded with patient stem cells that grow into functional tissue
- Ecovative Design
- Growing mycelium-based packaging, leather, and construction materials — IKEA and Dell replaced styrofoam with mycelium packaging.
- Bolt Threads Mylo
- Stella McCartney, Adidas, Lululemon, and Kering all using mycelium leather as a sustainable alternative to animal hides.
- 18 / 30
- Synthetic Biology

### Slide 19: Cells That Compute

- Biocomputing
- Genetic circuits inside living cells can perform Boolean logic, store memory, and execute programs — biology as a computational substrate for medicine and sensing.
- Cells programmed to detect cancer biomarkers and trigger self-destruction of only malignant cells
- Bacterial "sentinels" in the gut detecting inflammation and releasing therapeutic molecules on demand
- Cells that count exactly 3 stimuli before responding — enabling precise drug dosing programs
- DNA neural networks that classify molecular inputs without any silicon hardware
- The Living Pharmacy
- Engineered bacteria colonizing the gut, continuously monitoring health markers and dispensing tailored doses of therapeutic molecules — no daily pills required.
- 19 / 30
- Synthetic Biology

### Slide 20: iGEM: The Global Movement

- Community
- The International Genetically Engineered Machine (iGEM) Foundation runs an annual competition that built the world's largest open-source biological parts registry, democratizing synbio globally.
- 400+ teams from 40+ countries compete annually with novel synbio projects
- Registry of Standard Biological Parts — 20,000+ freely available BioBrick components
- High school students have built arsenic detectors, oil-eating bacteria, and cancer diagnostics
- Multiple successful biotech startups originated as iGEM student projects
- Global network of mentors, advisors, and former teams spanning every continent
- 20,000+open-source biological parts
- 400+teams from 40+ countries
- 2003first iGEM competition at MIT
- 20 / 30
- Synthetic Biology

### Slide 21: AlphaFold: Solving Proteins

- AI + Biology
- In 2021, DeepMind's AlphaFold 2 solved protein structure prediction with near-experimental accuracy — one of biology's most fundamental unsolved problems after 50 years of effort.
- Predicted structures for 200 million proteins — essentially all known proteins, freely accessible
- Drug discovery accelerated 10–100× — targets identified in days, not years
- Enabling design of entirely new proteins with custom functions never seen in nature
- Revealing malaria parasite protein structures critical for long-sought vaccines
- 2024 Nobel Prize in Chemistry awarded to the AlphaFold development team
- 200M
- protein structures predicted
- 92.4
- median GDT score — near-experimental accuracy
- 50yr
- central protein folding problem solved
- 21 / 30
- Synthetic Biology

### Slide 22: Xenobiology: Alien Alphabets

- Frontier
- Xenobiology expands the genetic alphabet beyond the 4-letter A, T, G, C code of all known life — creating organisms that literally cannot exist in nature and cannot exchange DNA with natural life.
- Scripps Research expanded DNA to 6 letters by adding novel X and Y base pairs
- Semi-synthetic organisms encode proteins with unnatural amino acids
- Creates a biological "firewall" — XNA organisms cannot interbreed with natural life
- Enables drugs with entirely new chemical properties impossible with standard amino acids
- May represent the most biosafe platform for industrial synthetic biology applications
- The Extended Alphabet
- Two additional, fully functional base pairs expand information density by 50% and unlock entirely new protein chemistries.
- 22 / 30
- Synthetic Biology

### Slide 23: Technical Hurdles

- Challenges
- Genetic stability — Engineered pathways burden cells; evolution quickly disables them over generations
- Off-target editing — CRISPR occasionally cuts near-similar sequences — improving specificity is critical for medicine
- In vivo delivery — Getting gene therapies into the right cells remains the field's hardest unsolved engineering problem
- Scale-up — Fermentation processes working in 1L often fail unpredictably at 10,000L industrial scale
- Biological noise — Living systems are inherently noisy; reliable function in cells is harder than in silicon circuits
- The Cost Curves That Matter
- Most synbio platforms need dramatic cost reductions before mass deployment:
- Gene therapy delivery: $100K → $1K per patient treatment
- Cell culture media: $10K → $10 per liter for cultivated meat
- DNA synthesis: $10/base (1990) → $0.01/base (2024) and falling
- 23 / 30
- Synthetic Biology

### Slide 24: Regulatory Landscape

- Policy
- USA
- FDA regulates gene therapies and GMO foods. USDA oversees engineered crops. EPA governs environmental release. A fragmented but functional framework.
- European Union
- Strict GMO regulation via Directive 2001/18/EC. New Genomic Techniques regulation under development — moving toward risk-based tiered approach.
- China
- Aggressive national synbio strategy with billions in state investment. Less restrictive framework enables faster domestic deployment of agricultural applications.
- He Jiankui (2018): A Chinese researcher edited CCR5 genes in human embryos for HIV resistance and implanted them — resulting in two births, global outrage, and landmark calls for an international moratorium on heritable germline editing.
- 24 / 30
- Synthetic Biology

### Slide 25: Bio as Strategic Asset

- Defense
- Biosurveillance — Environmental sensors using engineered organisms that fluoresce in the presence of specific pathogens
- Self-healing materials — Military equipment with biological self-repair capabilities reducing maintenance logistics
- Biofuels for logistics — On-site fermentation of jet fuel from local biomass, reducing supply chain vulnerability
- Biodetection — Soldier-wearable sensors detecting chemical and biological agents in seconds, not hours
- Bioremediation — Rapid cleanup of heavy metal and chemical contamination from military operations
- DARPA BTO Programs
- Safe Genes — biosafety tools and reversal mechanisms for synbio
- Living Foundries — automated national biofoundry network
- ReVector — mosquito gene drive for malaria elimination
- Prometheus — field-deployable pathogen detection
- 25 / 30
- Synthetic Biology

### Slide 26: Engineering Longevity

- Longevity
- Telomere extension — Synthetic telomerase constructs restoring chromosome end caps, reversing cellular aging markers in mice
- Yamanaka reprogramming — Partial cellular reprogramming restoring youthful epigenetic patterns without erasing cell identity
- Senolytics — Synthetic biology platforms targeting and selectively clearing senescent cells from aged tissues
- NAD+ metabolism — Engineered pathways boosting cellular energy production and DNA repair capacity
- Epigenetic clocks — AI-measured biological age that can now be reversed in animal models by 30–50%
- "Aging is simply damage accumulation. Biology causes damage; biology can also repair it — we just need to engineer the right repair programs."
- — Aubrey de Grey, SENS Research Foundation
- $3B+invested in longevity biotech 2021–2023
- 26 / 30
- Synthetic Biology

### Slide 27: Biology Meets Everything

- Convergence
- Synthetic biology's true power emerges at the intersection with other exponential technologies — each combination unlocking entirely new categories of capability.
- ML models design proteins and genetic circuits 1,000× faster than human researchers with experimental validation
- Robotics
- Automated biofoundries run experiments 24/7 at scales impossible for any human research team
- Nanotech
- DNA origami and protein nanomachines build programmable molecular structures atom by atom
- 3D Printing
- Bioprinting living tissues and organs layer by layer using cells as ink — functional liver tissue already printed
- 27 / 30
- Synthetic Biology

### Slide 28: Synthetic Biology 2030 Roadmap

- Roadmap
- Near Term (2025–2027)
- First FDA-approved CRISPR treatments at population scale
- Cultivated meat price-competitive with conventional beef
- mRNA vaccines for influenza, RSV, and HIV in trials
- First de-extinction species released in managed environments
- Mid Term (2027–2030)
- DNA data storage in commercial hyperscale data centers
- Xenotransplantation organ transplants become routine procedure
- Biofuel biorefineries scale to replace oil refineries
- Living gut medicines treating chronic inflammatory disease
- Horizon (2030+)
- Whole organ bioprinting from patient's own cells for transplant
- Partial biological age reversal demonstrated in human trials
- Engineered ecosystems for gigatonne-scale carbon removal
- Self-replicating molecular nanomachines for targeted medicine
- 28 / 30
- Synthetic Biology

### Slide 29: Rewriting Civilization

- Impact
- Medicine: from treating symptoms to curing disease at its genetic root
- Agriculture: from fighting nature to engineering sustainable abundance
- Manufacturing: from petroleum chemistry to biological fermentation of all materials
- Environment: from extracting resources to regenerating ecosystems using engineered biology
- Food: from factory farms to molecular manufacturing of nutrition with zero slaughter
- Computing: from silicon to living cellular logic that programs matter itself
- "Biology is the most sophisticated technology on Earth. It's been R&D'd for 3.8 billion years. We're just learning to program it."
- — Drew Endy, Stanford Bioengineering
- 29 / 30
- Synthetic Biology

### Slide 30: The Biological Century

- Summary
- Synthetic biology is not one technology — it is the operating system for life itself. As the cost of reading, writing, and editing DNA approaches zero, every industry will be disrupted and every material reimagined through the lens of programmable biology.
- 3.8Byears of R&D in nature's codebase
- $30Teconomic opportunity ahead
- ∞potential of life's programmable code
- ATCG · GCTA · TACG · CGAT · LIFE IS CODE · THE CENTURY OF BIOLOGY
- 30 / 30
- Synthetic Biology


## Related Decks

- [Asteroid Mining](https://shipslides.com/d/future-asteroid-mining)
- [Autonomous Vehicles](https://shipslides.com/d/future-autonomous-vehicles)
- [Brain-Computer Interfaces](https://shipslides.com/d/future-brain-computer-interfaces)
- [Climate Adaptation](https://shipslides.com/d/future-climate-adaptation)
